View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21582_high_16 (Length: 303)
Name: NF21582_high_16
Description: NF21582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21582_high_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 80; Significance: 2e-37; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 1 - 162
Target Start/End: Original strand, 14084638 - 14084797
Alignment:
| Q |
1 |
gggttctacggttgggtaaatacgggttgggtcgattaatgggtcattcagaatgttctgggcaaacagattttgctgcaannnnnnnnn-atttcttca |
99 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||| ||||||||| |
|
|
| T |
14084638 |
gggtcctacggttgggtaaatacaggttgggtcgattaatgggtcattcagaatgttctggacaaacggattttgctgcaattttttttttatttcttca |
14084737 |
T |
 |
| Q |
100 |
aaatgggccatttttt-atcatctttatactgagccatttagaaataaatatatggcccaatca |
162 |
Q |
| |
|
|||||| ||||||||| ||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
14084738 |
aaatggaccatttttttatcatctttataccgagccatttagaaat----atatggcccaatca |
14084797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 214 - 296
Target Start/End: Original strand, 14084849 - 14084930
Alignment:
| Q |
214 |
cttggatcatgttgtcataaacatattaaagtttttcctttaaaaagattgttaaatgcggatgttaaatgctgatgatgtcc |
296 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14084849 |
cttggatcatgttgtcgtaaat-tattaaagtttttcctttaaaaagattgttaaatgcggatgttaaatgctgatgatgtcc |
14084930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University