View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21582_high_19 (Length: 229)
Name: NF21582_high_19
Description: NF21582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21582_high_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 116; Significance: 4e-59; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 18 - 169
Target Start/End: Complemental strand, 3744021 - 3743875
Alignment:
| Q |
18 |
tggggattctcaaaattacattatacagagaatatctgtgtaaaatcgttgcgccctttcaaaaaatgcatgaacagtccgggtcaattgtgttgtgggt |
117 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
3744021 |
tggggcttctcaaaattacattatacagagaataaatgtgtaaaatcgttgcgccctttcaaaaaatgcatgaacagtccgggtcaat-----tgtgggt |
3743927 |
T |
 |
| Q |
118 |
catatacggtcttgacgaagttggacgtagatgaactgaatttgtaaagcca |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
3743926 |
catatacggtcttgacgaagttggacgtagataaactgaatttgtaaagcca |
3743875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 165 - 222
Target Start/End: Original strand, 3745052 - 3745109
Alignment:
| Q |
165 |
agccattgccttggcatctctaacataggatctagttggagcattgtgtgatgatgtc |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3745052 |
agccattgccttggcatctctaacataggatctagttggagcattgtgtgatgatgtc |
3745109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University