View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21582_low_10 (Length: 419)
Name: NF21582_low_10
Description: NF21582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21582_low_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 357; Significance: 0; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 357; E-Value: 0
Query Start/End: Original strand, 16 - 407
Target Start/End: Original strand, 5441031 - 5441427
Alignment:
| Q |
16 |
cactctcgaatgcagctgtaggttgtgccaatgtcgatgccaatggcttttctttttgttattgccacgacaattgagagtttgagaggagagaacaaaa |
115 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
5441031 |
cactctcaaatgcagctgtaggttgtgccaatgtcgatgccaatggcttttctttttgttattgccacgacaaacgagagtttgagaggagagaacaaaa |
5441130 |
T |
 |
| Q |
116 |
gaaaatgatgttttgggtagtaaactgaaaatctggatgtgattgataaaaaagaactcgtatttataggcaaagaaaacaggggtatttcttctatatc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5441131 |
gaaaatgatgttttgggtagtaaactgaaaatctggatgtgattgataaaaaagaactcgtatttataggcaaagaaaacaggggtatttcttctatatc |
5441230 |
T |
 |
| Q |
216 |
aaaagtcttattgaagaaaaattggggaatggggaaatgtatggaaaatacacaaataattgggcagagg-----aagattttgcaatttccaaagaact |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
5441231 |
aaaagtcttattgaagaaaaattggggaatggggaaatgtatggaaaatacacaaataattgggcagaggaagctaagattttgcaatttccaaagaact |
5441330 |
T |
 |
| Q |
311 |
tgaattggggtccttagcttgatcaagttttggaatcgtgtatttcaatattcattgatccttgatcaggtcattatttctacacattggaattcat |
407 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
5441331 |
tgaattggggtccttagcttgatcaagttttggaatcgtgtatttcaatattcattgatccttgatcaactcattatttctacacattggaattcat |
5441427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 24 - 167
Target Start/End: Complemental strand, 5445176 - 5445035
Alignment:
| Q |
24 |
aatgcagctgtaggttgtgccaatgtcgatgccaatggcttttctttttgttattgccacgacaattgagagtttgagaggagagaacaaaagaa-aatg |
122 |
Q |
| |
|
||||||||||||| |||| |||| ||| ||||| |||||||| |||||| || |||||| || || | ||||||||||||||||||||||| |||| |
|
|
| T |
5445176 |
aatgcagctgtagcttgtaccaaggtcaatgcctatggctttgctttttcttgttgccattgcacttaa---tttgagaggagagaacaaaagaagaatg |
5445080 |
T |
 |
| Q |
123 |
atgttttgggtagtaaactgaaaatctggatgtgattgataaaaa |
167 |
Q |
| |
|
|||||||| |||| ||| || ||| ||||| |||||||| |||| |
|
|
| T |
5445079 |
gtgttttggttagtgaaccgagaatatggatctgattgatcaaaa |
5445035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 358 - 407
Target Start/End: Complemental strand, 5444879 - 5444830
Alignment:
| Q |
358 |
atattcattgatccttgatcaggtcattatttctacacattggaattcat |
407 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| ||||||||| |
|
|
| T |
5444879 |
atattcattgatccttgatcaactcattatttctacacataggaattcat |
5444830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University