View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21582_low_16 (Length: 333)
Name: NF21582_low_16
Description: NF21582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21582_low_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 103; Significance: 3e-51; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 21 - 135
Target Start/End: Complemental strand, 14568018 - 14567904
Alignment:
| Q |
21 |
atccagatgctgcagatgttgtattcacaagtggcgcagatgttctcgccgtgggaataaacgttacacaacaagtcgtatttacaggtaccccccattg |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| || ||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14568018 |
atccagatgctgcagatgttgtattcacaagtggcgcagatgttcttgctgtggggataaacgttacacaacaagtcgtatttacaggtaccccccattg |
14567919 |
T |
|
| Q |
121 |
gaactctttgttgat |
135 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
14567918 |
gaactctttgttgat |
14567904 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 21 - 112
Target Start/End: Complemental strand, 14575710 - 14575619
Alignment:
| Q |
21 |
atccagatgctgcagatgttgtattcacaagtggcgcagatgttctcgccgtgggaataaacgttacacaacaagtcgtatttacaggtacc |
112 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||| | ||||| ||||||||||| || || || ||||||||||| |||||||| |
|
|
| T |
14575710 |
atccagatgctgcagatgttgtgttcacaagtggcgcagatatactcgcagtgggaataaatgtcactcaccaagtcgtattgtcaggtacc |
14575619 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 280 - 317
Target Start/End: Complemental strand, 14567895 - 14567858
Alignment:
| Q |
280 |
aacaacatgatcatgctgctttttaaattttgattcat |
317 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
14567895 |
aacaacatgatcatgctgctattttaattttgattcat |
14567858 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University