View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21585_high_38 (Length: 254)
Name: NF21585_high_38
Description: NF21585
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21585_high_38 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 19 - 254
Target Start/End: Complemental strand, 9008873 - 9008630
Alignment:
| Q |
19 |
cccaaaagtgttaaagcataacttctttgctacacaaaattctaccaacagcatgttcacagagagtgtgaccatcatgaggaaaaacatagagaagaca |
118 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9008873 |
cccaaaagtgttaaagcataacttctttgttacacaaaattctaccaacagcatgttcacagagagtgtgaccatcatgaggaaaaacatagagaagaca |
9008774 |
T |
 |
| Q |
119 |
aaaacatccctgtgaaactaaacttaaaaccttaaatgtc--------ttcatcatcttaagaacttcttcctggaatctcttataaattggtatcatta |
210 |
Q |
| |
|
|||||||||||| ||||||||||| ||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9008773 |
aaaacatccctgcgaaactaaactcaaaaccttaaatgtctctcaaagttcatcatcttaagaacttcttcctggattctcttataaattggtatcatta |
9008674 |
T |
 |
| Q |
211 |
tctggtttcgatgcatcttcttcgttaagtatcttcccatctct |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9008673 |
tctggtttcgatgcatcttcttcgttaagtatcttcccatctct |
9008630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University