View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21585_low_19 (Length: 333)
Name: NF21585_low_19
Description: NF21585
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21585_low_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 181; Significance: 9e-98; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 181; E-Value: 9e-98
Query Start/End: Original strand, 17 - 247
Target Start/End: Original strand, 39078333 - 39078576
Alignment:
| Q |
17 |
caagaaacgtttgtgtttgaattggaattagctagaaagtagagatgttttcaaaaccaacagcaatgataaaaggtagcagactaatgtcatatagaat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
39078333 |
caagaaacgtttgtgtttgaattggaattagctagaaagtagagatgttttcaaaaccaacagcaatgat-aaaggtagcagactaatgtcatatagaat |
39078431 |
T |
 |
| Q |
117 |
aaatttaaaccatttctgaggggtcaatcttcat------------ttgatagttcactgtgtacattagtcctcaaaattggtcaccacttaatgcaat |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39078432 |
aaatttaaaccatttctgaggggtcaatcttcatttaatgggatgattgatagttcactgtgtacattagtcctcaaaattggtcaccacttaatgcaat |
39078531 |
T |
 |
| Q |
205 |
gtgtacttcttattcattttggacccttg--attgatagcttcat |
247 |
Q |
| |
|
|||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
39078532 |
gtgtacttattattcattttggacccttgatattgatagcttcat |
39078576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 255 - 304
Target Start/End: Original strand, 39078620 - 39078669
Alignment:
| Q |
255 |
attcatggccctctctcacctctacctttccaaaatatcatatctgattt |
304 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
39078620 |
attcatggccctttcttacctctacctttccaaaatatcatatctgattt |
39078669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University