View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21585_low_20 (Length: 325)
Name: NF21585_low_20
Description: NF21585
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21585_low_20 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 20 - 315
Target Start/End: Original strand, 52274023 - 52274320
Alignment:
| Q |
20 |
actttttggttttggaaacaaaggctttaaccttgtcgaattaaaacggatcgtgaaatggttctagtccaaacctaacctaaataaatggcggtaaatt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
52274023 |
actttttggttttggaaacaaaggctttaaccttatcgaattaaaacggatcgtgaaatggttctagtctaaacctaacctaaataaatggcggtaaatt |
52274122 |
T |
 |
| Q |
120 |
tgtttgaaaattctataaa--cgcgccatacnnnnnnnnnnnnnngaaattgcttttattttaacgccannnnnnnnnnc------aatttaatttaatt |
211 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
52274123 |
tgtttgaaaattctataaaaacgcgccatacaaaaaaaa------gaaattgcttttattttaacgccatttttttttttcaatttaatttaatttaatt |
52274216 |
T |
 |
| Q |
212 |
ttgcacatgttaatttagctaggtatacgggtctctgtttacacttttttgggtcagactgcaatgacctacaaacttaataaaatcgattgttccaccc |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
52274217 |
ttgcacatgttaatttagctaggtatacgggtctctgtttacacttttttgggtcagactgcaatgacctacaaacttaataaaattgattgttccaccc |
52274316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University