View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21585_low_21 (Length: 313)
Name: NF21585_low_21
Description: NF21585
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21585_low_21 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 238; Significance: 1e-132; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 70 - 307
Target Start/End: Complemental strand, 33183522 - 33183285
Alignment:
| Q |
70 |
agtatttatttgattgacctctacatgtaatgcaattggggttgacttgactttcattttatttggttatttttgcattgccactaattagctgtttttc |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33183522 |
agtatttatttgattgacctctacatgtaatgcaattggggttgacttgactttcattttatttggttatttttgcattgccactaattagctgtttttc |
33183423 |
T |
|
| Q |
170 |
acgcgtgttgagtattgacttaacaaaaccatagacttaagtagaagaatggaaataaattgcacctatgaactacttgctgagaaagaagaaaaagaac |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33183422 |
acgcgtgttgagtattgacttaacaaaaccatagacttaagtagaagaatggaaataaattgcacctatgaactacttgctgagaaagaagaaaaagaac |
33183323 |
T |
|
| Q |
270 |
atttttattactatttgcaactacatcatgatgatgtc |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33183322 |
atttttattactatttgcaactacatcatgatgatgtc |
33183285 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 23 - 77
Target Start/End: Original strand, 33183775 - 33183829
Alignment:
| Q |
23 |
attcaaagtaaaccttgagtttatctgcttaagagcgatcttcatgaagtattta |
77 |
Q |
| |
|
|||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33183775 |
attcaaagtagaccttaagtttatctgcttaagagcgatcttcatgaagtattta |
33183829 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University