View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21585_low_22 (Length: 310)

Name: NF21585_low_22
Description: NF21585
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21585_low_22
NF21585_low_22
[»] chr6 (2 HSPs)
chr6 (111-178)||(32241100-32241167)
chr6 (242-310)||(32241233-32241301)


Alignment Details
Target: chr6 (Bit Score: 68; Significance: 2e-30; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 111 - 178
Target Start/End: Original strand, 32241100 - 32241167
Alignment:
111 gtgtttagttatgaagcatgatcacacaataagaaacttaatcattaattaaaaaagagttgtgacat 178  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32241100 gtgtttagttatgaagcatgatcacacaataagaaacttaatcattaattaaaaaagagttgtgacat 32241167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 242 - 310
Target Start/End: Original strand, 32241233 - 32241301
Alignment:
242 ggagagaattcatactcataagatgataataaacatggtcgaatgctaagaatgaagatattatatata 310  Q
    ||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
32241233 ggagagaattcattctcataagatgataagaaacatggtcgaatgctaagaatgaagatattatatata 32241301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University