View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21585_low_32 (Length: 284)
Name: NF21585_low_32
Description: NF21585
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21585_low_32 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 170; Significance: 3e-91; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 41 - 270
Target Start/End: Original strand, 41795295 - 41795522
Alignment:
| Q |
41 |
atgaacaaatatgtgagattatgttgagattggtggtataaattaatgaaatatagttacataatnnnnnnnnnnnnnntagatgttat----ctcattc |
136 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
41795295 |
atgaacaaatatgtgagattatgttgagattggtggtataaattaatgaaatatagttacataataaaaaaaa------tagatgttatatatctcattc |
41795388 |
T |
 |
| Q |
137 |
caatttcattcaaattcatcctaccttatgcaaacaatccaaagataattagttacctcttcttgaagtttctgtttttccttggagacaacatcaaatt |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41795389 |
caatttcattcaaattcatcctaccttatgcaaacaatccaaagataattagttacctcttcttgaagtttctgtttttccttggagacaacatcaaatt |
41795488 |
T |
 |
| Q |
237 |
cttgtttcaaaacatcatacaagtgttcaagctg |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
41795489 |
cttgtttcaaaacatcatacaagtgttcaagctg |
41795522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University