View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21585_low_45 (Length: 240)
Name: NF21585_low_45
Description: NF21585
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21585_low_45 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 20 - 223
Target Start/End: Complemental strand, 42677140 - 42676935
Alignment:
| Q |
20 |
agaaggagcacgatcaccaaagtgtgatcgatattagtaatgactaatgacagggaaagtggaggaaagacgctatatattgcttagagtggtctccaag |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42677140 |
agaaggagcacgatcaccaaagtgtgatcgatattagtaatgactaatgacagggaaagtggaggaaagacgctatatattgcttagagtggtctccaag |
42677041 |
T |
 |
| Q |
120 |
tttgtcataaaaagatttactaattatttgattcaaa--tataacttttataaaaagatttggttagtatttatttcattgaa----atagaacttttag |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||| ||| ||||||||| |
|
|
| T |
42677040 |
tttgtcataaaaagatttactaattatttgattcaaatatataacttttataaaaagatttggtta----ttatttcattgaaatatatataacttttag |
42676945 |
T |
 |
| Q |
214 |
agggaatatt |
223 |
Q |
| |
|
|||||||||| |
|
|
| T |
42676944 |
agggaatatt |
42676935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University