View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21585_low_48 (Length: 227)
Name: NF21585_low_48
Description: NF21585
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21585_low_48 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 20 - 227
Target Start/End: Original strand, 54471074 - 54471279
Alignment:
| Q |
20 |
ttttgtccttctatactaagcaacaattggctagttttatttcatttttagtttcagcgccatcatgaaaatacatcgatgcgagacgagacatttcgaa |
119 |
Q |
| |
|
|||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
54471074 |
ttttgtcctttttaactaagcaacaattggctagttttatttcatttttagtttcagcgccatcatgaaaatacatcgatg--atgcgagacatttcgaa |
54471171 |
T |
 |
| Q |
120 |
ccagtttgcaaacactaaggagtcatatttggttgtaataacaaacagacagagcacaacacacgtgatgaccaatgttttgattaagattaaattttgt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54471172 |
ccagtttgcaaacactaaggagtcatatttggttgtaataacaaacagacagagcacaacacacgtgatgaccaatgttttgattaagattaaattttgt |
54471271 |
T |
 |
| Q |
220 |
ttagcact |
227 |
Q |
| |
|
|||||||| |
|
|
| T |
54471272 |
ttagcact |
54471279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University