View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21585_low_50 (Length: 219)
Name: NF21585_low_50
Description: NF21585
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21585_low_50 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 15 - 201
Target Start/End: Complemental strand, 29935304 - 29935117
Alignment:
| Q |
15 |
cagagataaatttagaaagtttcacaacaatgtggagagcctaaagaactattagcaatggagttgcannnnnnn-gctctaccattaagatagggtaat |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
29935304 |
cagagataaatttagaaagtttcacaacaatgtggagagcctaaagaaccattagcaatggagttgcattttttttgctctaccattaagatagggtaat |
29935205 |
T |
|
| Q |
114 |
attctttttataataaaataagtgaatattttgttgtcgttttgaaaattaaaatgatgtaatctaatgtataattttagtcaaagtg |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29935204 |
attctttttataataaaataagtgaatattttgttgtcgttttgaaaattaaaatgatgtaatctaatgtataattttagtcaaagtg |
29935117 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University