View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21585_low_51 (Length: 216)
Name: NF21585_low_51
Description: NF21585
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21585_low_51 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 206
Target Start/End: Complemental strand, 1857704 - 1857499
Alignment:
| Q |
1 |
ccgtaaaaattaccatcttctctggtagcgccgtcgtcgaaattcaaagcataactcgacgaatcataattcaacgtaccttgtttaacataactattcc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1857704 |
ccgtaaaaattaccatcttctctggtagcgccgtcgtcgaaattcaaagcataactcgacggatcataattcaacgtaccttgtttaacataactattcc |
1857605 |
T |
|
| Q |
101 |
gattcttaccgaatcgacgaatgaacgttttccatttcggacctgcaacaatctctgacaattcacgtaccttcatccatccacgaaaccaccattgatg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1857604 |
gattcttaccgaatcgacgaatgaacgttttccatttcggacctgcaacaatctctgacaattcacgtaccttcatccatccacgaaaccaccattgatg |
1857505 |
T |
|
| Q |
201 |
atgatg |
206 |
Q |
| |
|
|||||| |
|
|
| T |
1857504 |
atgatg |
1857499 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University