View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21585_low_52 (Length: 208)
Name: NF21585_low_52
Description: NF21585
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21585_low_52 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 111; Significance: 3e-56; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 1 - 123
Target Start/End: Original strand, 47782890 - 47783011
Alignment:
| Q |
1 |
tttcgaaatggaagtatataagaactcagcataaaagtaaacaacggaaatggtcagttaatccataataaagaagaattatacataggttcggaaatcg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47782890 |
tttcgaaatggaagtatataagaactcaacataaaagtaaacaacggaaatggtcagttaatccataataaagaagaattatacataggttcggaaatcg |
47782989 |
T |
|
| Q |
101 |
gtttctattgcttaacaaactat |
123 |
Q |
| |
|
||||||||||| ||||||||||| |
|
|
| T |
47782990 |
gtttctattgc-taacaaactat |
47783011 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 109 - 188
Target Start/End: Complemental strand, 47782806 - 47782726
Alignment:
| Q |
109 |
tgcttaacaaactatgaagtcgatgtaggaaaataataa-ggaagtcataggagagagactattaagagttccacatactt |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47782806 |
tgcttaacaaactatgaagtcgatgtaggaaaataaaaaaggaagtcataggagagagactattaagagttccacatactt |
47782726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University