View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21585_low_53 (Length: 208)

Name: NF21585_low_53
Description: NF21585
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21585_low_53
NF21585_low_53
[»] chr7 (1 HSPs)
chr7 (1-188)||(47782726-47782914)
[»] chr8 (1 HSPs)
chr8 (16-62)||(39382057-39382103)


Alignment Details
Target: chr7 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 1 - 188
Target Start/End: Complemental strand, 47782914 - 47782726
Alignment:
1 gttcttatatacttccatttcgaaaacataattcatctcattactacagggatgatcccaattagaaattaaactagcttttcattgtgaaggctatctc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47782914 gttcttatatacttccatttcgaaaacataattcatctcattactacagggatgatcccaattagaaattaaactagcttttcattgtgaaggctatctc 47782815  T
101 gcatttcatgcttaacaaactatgaagtcgatgtaggaaaat-aataaggaagtcataggagagagactattaagagttccacatactt 188  Q
    |||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||    
47782814 gcatttcatgcttaacaaactatgaagtcgatgtaggaaaataaaaaaggaagtcataggagagagactattaagagttccacatactt 47782726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 35; Significance: 0.00000000007; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 16 - 62
Target Start/End: Complemental strand, 39382103 - 39382057
Alignment:
16 catttcgaaaacataattcatctcattactacagggatgatcccaat 62  Q
    |||||||||||| |||||||||  |||||||||||||||||||||||    
39382103 catttcgaaaacttaattcatccaattactacagggatgatcccaat 39382057  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University