View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21585_low_7 (Length: 531)
Name: NF21585_low_7
Description: NF21585
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21585_low_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 455; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 455; E-Value: 0
Query Start/End: Original strand, 19 - 514
Target Start/End: Original strand, 43863796 - 43864291
Alignment:
| Q |
19 |
ttaacgtgtctcttcacaccttgcagatcaaacatcttcaccactggaaaataatcagaaacattcactttcccagcatcttccattatcctccatacaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43863796 |
ttaacgtgtctcttcacaccttgcagatcaaacatcttcaccactggaaaataatcagaaacattcactttcccagcatcttccattatcctccatacaa |
43863895 |
T |
 |
| Q |
119 |
gctctttaaactcaccagcactctcgaactccgaatcaacaaggtcctctgagaacaccgtgttggaaaccaagttcaacattgtggcgaaagcaagttc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
43863896 |
gctctttaaactcaccagcactctcgaactccgaatcaacaaggtcctctgagaacaccgtgttggaaaccaagttcaacatggtggcgaaagcaagttc |
43863995 |
T |
 |
| Q |
219 |
acctatgtcaacggttgttttctctactgcttttttgtgaaggtgttggactagttgctcaactttccggtgacggagatgttggagaaggtcaaggcgg |
318 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43863996 |
acctatgtcaacggttgttttctctgctgcttttttgtgaaggtgttggactagttgctcaactttccggtgacggagatgttggagaaggtcaaggcgg |
43864095 |
T |
 |
| Q |
319 |
tgggtggtgaatatttgtgtggtgcagatacgtctacggttgcgccaccgtgagtcggcatgggaccatgcgagtgtgtcgttgacgttgggttgagcag |
418 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43864096 |
tgggtggtgaatatttgtgtggtgcagatacgtctacggttacgccaccgtgagtcggcatgggaccatgcgagtgtgtcgttgacgttgggttgagcag |
43864195 |
T |
 |
| Q |
419 |
caactgattcagggatagggcggttggcgaaggattggtcgnnnnnnnggaggatttcttgggcggttgtcggggaggaagcaacggtgacagtga |
514 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||| |||| |
|
|
| T |
43864196 |
caactgattcagggatagggcggttggcgaaggattggtcgtttttttggaggatttcttgggcggttttcggggaggaagcaacggtgacggtga |
43864291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University