View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21586_high_7 (Length: 261)
Name: NF21586_high_7
Description: NF21586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21586_high_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 208; Significance: 1e-114; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 22 - 253
Target Start/End: Original strand, 42339053 - 42339284
Alignment:
| Q |
22 |
tggtatccaaattggatgggcaatacaatttacaactttaatcccttgtatccaagatgcttatgtcccttggatggccaatacagttcacccctgattg |
121 |
Q |
| |
|
||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
42339053 |
tggtatccaaattggatgggcaatacagtttgcaactttaatcccttgtatccaagatgcttatgtcccttggatgggcaatacagttcacccctgattg |
42339152 |
T |
|
| Q |
122 |
gttgcaatgtgactgctcaactcatactactcatagtgcttaccatttaagcttttgcttgtagtttaatgttttaatgacagaaatttgggaatgaaga |
221 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42339153 |
gttgcaatgtgactgctcaactcatattactcatagtacttaccatttaagcttttgcttgtagtttaatgttttaatgacagaaatttgggaatgaaga |
42339252 |
T |
|
| Q |
222 |
tatttagtccccttataaagtttatgatgatg |
253 |
Q |
| |
|
||||||||||||||||||||||||| |||||| |
|
|
| T |
42339253 |
tatttagtccccttataaagtttattatgatg |
42339284 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 22 - 78
Target Start/End: Complemental strand, 42276418 - 42276362
Alignment:
| Q |
22 |
tggtatccaaattggatgggcaatacaatttacaactttaatcccttgtatccaaga |
78 |
Q |
| |
|
|||||||||| |||||||||||||||| || ||||||||||||| ||||||||| |
|
|
| T |
42276418 |
tggtatccaatttggatgggcaatacatttcgacactttaatcccttatatccaaga |
42276362 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University