View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21586_low_11 (Length: 220)
Name: NF21586_low_11
Description: NF21586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21586_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 13 - 205
Target Start/End: Complemental strand, 32189502 - 32189310
Alignment:
| Q |
13 |
aattattctgcacatggacaatgagatgctcatgatgatgataaaaattaattcaaagnnnnnnnncaagaaatttgatgtaagaattggaatcgattag |
112 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
32189502 |
aattagtctgcacatggacaatgagatgctcatgatgatgataaaaattaattcaaagaaaaaaaacaagaaatttgatgtaagaattggaatcgattag |
32189403 |
T |
 |
| Q |
113 |
tactacgtcgactttggtgggagacttttgattcagataacaactaacgtactaatatttgtctacacgaaaaattgttggagaggtgatttt |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
32189402 |
tactacgtcgactttggtgggagacttttgattcagataacaactaacgtactaatatttgtctatacgaaaaattattggagaggtgatttt |
32189310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University