View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21586_low_5 (Length: 342)
Name: NF21586_low_5
Description: NF21586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21586_low_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 161; Significance: 8e-86; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 161; E-Value: 8e-86
Query Start/End: Original strand, 111 - 291
Target Start/End: Original strand, 25254532 - 25254712
Alignment:
| Q |
111 |
tacatatatttcataaaggaagcatttatgtgaaggtaataatttttatttatgaggattctaaccttactaagccatatgcaaaaccaaactgttccta |
210 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||| |||| | ||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
25254532 |
tacatatatttcgtaaaggaagcatttatgtgaaggtaataatttttatgtatgcgaattctaaccttactaagccatatacaaaaccaaactgttccta |
25254631 |
T |
|
| Q |
211 |
gagaaccaaaggagtaaaacaccgatggccatccatactgatgaattaggaaaggtgaaaaggccaatccagtgaccgatc |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25254632 |
gagaaccaaaggagtaaaacaccgatggccatccatactgatgaattaggaaaggtgaaaaggccaatccagtgaccgatc |
25254712 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 12 - 46
Target Start/End: Original strand, 25254434 - 25254468
Alignment:
| Q |
12 |
atcatcaagtggtgaactatgtgcctacaggtccc |
46 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |
|
|
| T |
25254434 |
atcatcaagtggcgaactatgtgcctacaggtccc |
25254468 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University