View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21586_low_7 (Length: 261)

Name: NF21586_low_7
Description: NF21586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21586_low_7
NF21586_low_7
[»] chr4 (2 HSPs)
chr4 (22-253)||(42339053-42339284)
chr4 (22-78)||(42276362-42276418)


Alignment Details
Target: chr4 (Bit Score: 208; Significance: 1e-114; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 22 - 253
Target Start/End: Original strand, 42339053 - 42339284
Alignment:
22 tggtatccaaattggatgggcaatacaatttacaactttaatcccttgtatccaagatgcttatgtcccttggatggccaatacagttcacccctgattg 121  Q
    ||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
42339053 tggtatccaaattggatgggcaatacagtttgcaactttaatcccttgtatccaagatgcttatgtcccttggatgggcaatacagttcacccctgattg 42339152  T
122 gttgcaatgtgactgctcaactcatactactcatagtgcttaccatttaagcttttgcttgtagtttaatgttttaatgacagaaatttgggaatgaaga 221  Q
    |||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42339153 gttgcaatgtgactgctcaactcatattactcatagtacttaccatttaagcttttgcttgtagtttaatgttttaatgacagaaatttgggaatgaaga 42339252  T
222 tatttagtccccttataaagtttatgatgatg 253  Q
    ||||||||||||||||||||||||| ||||||    
42339253 tatttagtccccttataaagtttattatgatg 42339284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 22 - 78
Target Start/End: Complemental strand, 42276418 - 42276362
Alignment:
22 tggtatccaaattggatgggcaatacaatttacaactttaatcccttgtatccaaga 78  Q
    |||||||||| |||||||||||||||| ||    ||||||||||||| |||||||||    
42276418 tggtatccaatttggatgggcaatacatttcgacactttaatcccttatatccaaga 42276362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University