View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21586_low_9 (Length: 232)
Name: NF21586_low_9
Description: NF21586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21586_low_9 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 7 - 232
Target Start/End: Complemental strand, 36606574 - 36606349
Alignment:
| Q |
7 |
ggacatcatcagttacctaa---tcatctgccacatgtttctagagagcctttgaaggcttttgaaagtagtaccaaaggaatgcaagcaaccagcaaca |
103 |
Q |
| |
|
|||||||||| ||| ||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36606574 |
ggacatcatcggttgcctaacggtcatctgccacatgtttctaaagagcctttgaaggcttttgaaagtagtaccaaaggaatgcaagcaaccagcaac- |
36606476 |
T |
 |
| Q |
104 |
attctgtttcatcttcagtctccattcaaggatttgaactttttgacttcgcaaacacttttattgacttgagtgaaccaacaccccctgaacatgggag |
203 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36606475 |
--tctgtttcatcttcagtctctattcaaggatttgaactttttgactttgcaaacacttttattgacttgagtgaaccaacaccccctgaacatgggag |
36606378 |
T |
 |
| Q |
204 |
ttttaatcacactgaaattgtgggatcac |
232 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
36606377 |
ttttaatcacactgaaattgtgggatcac |
36606349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University