View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21587_high_17 (Length: 230)

Name: NF21587_high_17
Description: NF21587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21587_high_17
NF21587_high_17
[»] chr5 (2 HSPs)
chr5 (120-213)||(26613703-26613796)
chr5 (13-54)||(26613597-26613638)


Alignment Details
Target: chr5 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 120 - 213
Target Start/End: Original strand, 26613703 - 26613796
Alignment:
120 atatgatatgataaatattgaatgtgcaggtaacatttcgtgatccagaatcagctagaagggcttgtgctgatccaaacccagtaattgatgg 213  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26613703 atatgatatgataaatattgattgtgcaggtaacatttcgtgatccagaatcagctagaagggcttgtgctgatccaaacccagtaattgatgg 26613796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 13 - 54
Target Start/End: Original strand, 26613597 - 26613638
Alignment:
13 tgatatgaacacaggaaaatctaaaggatacggatttgtatg 54  Q
    ||||| ||||||||||||||||||||||||||||||||||||    
26613597 tgataagaacacaggaaaatctaaaggatacggatttgtatg 26613638  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University