View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21587_low_17 (Length: 230)
Name: NF21587_low_17
Description: NF21587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21587_low_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 120 - 213
Target Start/End: Original strand, 26613703 - 26613796
Alignment:
| Q |
120 |
atatgatatgataaatattgaatgtgcaggtaacatttcgtgatccagaatcagctagaagggcttgtgctgatccaaacccagtaattgatgg |
213 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26613703 |
atatgatatgataaatattgattgtgcaggtaacatttcgtgatccagaatcagctagaagggcttgtgctgatccaaacccagtaattgatgg |
26613796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 13 - 54
Target Start/End: Original strand, 26613597 - 26613638
Alignment:
| Q |
13 |
tgatatgaacacaggaaaatctaaaggatacggatttgtatg |
54 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
26613597 |
tgataagaacacaggaaaatctaaaggatacggatttgtatg |
26613638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University