View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21587_low_22 (Length: 203)
Name: NF21587_low_22
Description: NF21587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21587_low_22 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 132; Significance: 9e-69; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 132; E-Value: 9e-69
Query Start/End: Original strand, 20 - 185
Target Start/End: Complemental strand, 35320149 - 35319984
Alignment:
| Q |
20 |
aagaatggttgagatataaataaggnnnnnnnnnnttaaggtaaaaatggagaaatgaaagttgaaattttgtgtttggttttattgttaagagttcaaa |
119 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35320149 |
aagaatggttgagatataaataaggaaaaaaaaaattaaggtaaaaatggagaaatgaaagttgaaattttgtgtttggttttattgttaagagttcaaa |
35320050 |
T |
 |
| Q |
120 |
gagatgtttggtttttatagagtgtacttgtctgtttcatctccttttatcagttatgagtctgtg |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
35320049 |
gagatgtttggtttttatagagtgtacttgtctgtttcatctccttttatcagttatgagtttgtg |
35319984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University