View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21589_high_10 (Length: 278)
Name: NF21589_high_10
Description: NF21589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21589_high_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 19 - 235
Target Start/End: Complemental strand, 35814549 - 35814342
Alignment:
| Q |
19 |
gaactagtggattttgactcttgagatattgattaaaggtgttccaatctctacgtttttgagattcatacctgcttagtggttgttgttgctgatgatc |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35814549 |
gaactagtggattttgactcttgagatattgattaaaggtgttccaatctctacgtttttgagattcatacctgcttagtggttgttgttgctgatgat- |
35814451 |
T |
 |
| Q |
119 |
atgatgatgattggatttggaagaagatgcgtgaagagaagagttttcgatttgggaagaggaagaagacatgttttgtggttgacagggtaaggtgaaa |
218 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35814450 |
--------gattggatttggaagaagatgggtgaagagaagagttttcgatttgggaagaggaagaagacatgttttgtggttgacagggtaaggtgaaa |
35814359 |
T |
 |
| Q |
219 |
gaatgaatgtattgtat |
235 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
35814358 |
gaatgaatgtattgtat |
35814342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University