View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21589_low_13 (Length: 241)
Name: NF21589_low_13
Description: NF21589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21589_low_13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 18 - 230
Target Start/End: Original strand, 5018814 - 5019026
Alignment:
| Q |
18 |
ataaggccacttcatatctattcaatactcataaaatgtgttatactaaaatctcttatcgctctgatttattgtcattctgtttacacaggtatatttt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
5018814 |
ataaggccacttcatatctattcaatactcataaaatgtgttatactagtatctcttatcgctctgatttattgtcattctgtttacacaagtatatttt |
5018913 |
T |
|
| Q |
118 |
aattttcgacctaagtcttttgtttctctcatttttgcaggaaactttattttgaagtctggtgtttggacttttgtaaagccatgtaattgagctagct |
217 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5018914 |
aattttcgacctaagtcttttgtttctatcatttttgcaggaaactttattttgaagtctggtgtttggacttttgtaaagccatgtaattgagctagct |
5019013 |
T |
|
| Q |
218 |
gtgttaagtgatg |
230 |
Q |
| |
|
||||||||||||| |
|
|
| T |
5019014 |
gtgttaagtgatg |
5019026 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University