View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21589_low_9 (Length: 281)
Name: NF21589_low_9
Description: NF21589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21589_low_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 18 - 267
Target Start/End: Complemental strand, 38101233 - 38100983
Alignment:
| Q |
18 |
cgtatcaaagaggcttttgatgatatcaataggccagcacctgtaccagttggaatcatcgattctttaggggtcctaactgagaaatttggaagaagag |
117 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38101233 |
cgtatcaaagaggcttttgatggtatcaataggccagcacctgtaccagttggaatcatcgattctttaggggtcctaactgagaaatttggaagaagag |
38101134 |
T |
 |
| Q |
118 |
ctggtaatatgaaggtatgtcaagtatcaagaatatatagaagcaagtgattcataatt-ctcacaatttcaagttcttaacactattatatttatgggc |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38101133 |
ctggtaatatgaaggtatgtcaagtatcaagaatatatagaagcaagtgattcataattcctcacaatttcaagttcttaacactattatatttatgggc |
38101034 |
T |
 |
| Q |
217 |
agatggcaacattggcttcttattttggcttggggcaacaaaaacacaggt |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38101033 |
agatggcaacattggcttcttattttggcttggggcaacaaaaacacaggt |
38100983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University