View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2158_high_103 (Length: 203)
Name: NF2158_high_103
Description: NF2158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2158_high_103 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 121; Significance: 3e-62; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 121; E-Value: 3e-62
Query Start/End: Original strand, 62 - 203
Target Start/End: Original strand, 2176482 - 2176623
Alignment:
| Q |
62 |
gtggtgttgtggtttttatcnnnnnnncttgtattggatttgagagtgagaaagggattattatagggacttgtttgtagtactaagttgttgttatctt |
161 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2176482 |
gtggtgttgtggtttttatctttttttcttgtattggatttgagagtgagaaagggattattatagggacttgtttgtagtactaagttgttgttatctt |
2176581 |
T |
|
| Q |
162 |
caccggttggtggctggattctgcatgctattaaattggatt |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2176582 |
caccggttggtggctggattctgcatgctattaaattggatt |
2176623 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University