View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2158_high_103 (Length: 203)

Name: NF2158_high_103
Description: NF2158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2158_high_103
NF2158_high_103
[»] chr2 (1 HSPs)
chr2 (62-203)||(2176482-2176623)


Alignment Details
Target: chr2 (Bit Score: 121; Significance: 3e-62; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 121; E-Value: 3e-62
Query Start/End: Original strand, 62 - 203
Target Start/End: Original strand, 2176482 - 2176623
Alignment:
62 gtggtgttgtggtttttatcnnnnnnncttgtattggatttgagagtgagaaagggattattatagggacttgtttgtagtactaagttgttgttatctt 161  Q
    ||||||||||||||||||||       |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2176482 gtggtgttgtggtttttatctttttttcttgtattggatttgagagtgagaaagggattattatagggacttgtttgtagtactaagttgttgttatctt 2176581  T
162 caccggttggtggctggattctgcatgctattaaattggatt 203  Q
    ||||||||||||||||||||||||||||||||||||||||||    
2176582 caccggttggtggctggattctgcatgctattaaattggatt 2176623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University