View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2158_high_75 (Length: 296)
Name: NF2158_high_75
Description: NF2158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2158_high_75 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 7 - 289
Target Start/End: Original strand, 1112771 - 1113053
Alignment:
| Q |
7 |
taaattatacggatttcacattggtaaattagagtgaggcagatgatatcgattaaactttccggtctcagattatatttaaaataaggcatgcaattag |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1112771 |
taaattatacggatttcacattggtaaattagagtgaggcagatgatatcgattaaactttccggtctcagattatatttaaaataaggcatgcaattag |
1112870 |
T |
 |
| Q |
107 |
aaaataacaattttgctagtgtggctcatggacgtaatttggtccttctactcttctagtataggttgtgttatggattattccattggttgcactgacg |
206 |
Q |
| |
|
| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
1112871 |
agaataacaattttgctagtgtggctaatggacgtaatttggtccttctactcttctagtataggttgtgttatggattattccattggttgcacagacg |
1112970 |
T |
 |
| Q |
207 |
cacagtagttagatactcatgcttacctgtctctctatatcagcatcgtaacatggtatagaagtacttaaaatgatgatgtc |
289 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
1112971 |
cacagtagttagatactcatgcttacttgtctctctatatcagcatcgtatcatggtatagaagtacttaaaatgatgctgtc |
1113053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University