View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2158_high_81 (Length: 273)
Name: NF2158_high_81
Description: NF2158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2158_high_81 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 18 - 261
Target Start/End: Original strand, 37790031 - 37790280
Alignment:
| Q |
18 |
gaaaccccaaagaaaaggcaacggtccgtgtcccctttcctttgtcgtcgt-------caccattcccttgcagttgttcatattcacagttgttttatc |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || ||||||||||||| ||||||||||||||| | |||||| |||| ||||||||||| |
|
|
| T |
37790031 |
gaaaccccaaagaaaaggcaacggtccgtgtcccattacctttgtcgtcgttcgtcgtcaccattcccttgcact-gttcatcgtcacggttgttttatc |
37790129 |
T |
 |
| Q |
111 |
atgaaacatctcttatcattactccgtcgaagactgagttccataacgaaacctctgatccaccaccaccatcgtagacactgagttttgtcggttgcac |
210 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37790130 |
atgaaacatctcttatcattgctccttcgaagactgagttccataacgaaacctctgatccaccaccaccatcgtagacactgagttttgtcggttgcac |
37790229 |
T |
 |
| Q |
211 |
tctgagtatccgagtttgacttagttggtcaccagttgaaagtcttggtat |
261 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
37790230 |
tctgagtatccgagtttgactcagttggtcaccgattgaaagtcttggtat |
37790280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University