View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2158_low_100 (Length: 239)
Name: NF2158_low_100
Description: NF2158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2158_low_100 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 155; Significance: 2e-82; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 55 - 221
Target Start/End: Complemental strand, 46885551 - 46885385
Alignment:
| Q |
55 |
catcttcatatattgatcatgatttggaaatccatcaaaaatattcaagtatgaatgttcttgattattattataagcttcttcttgttgttgatgctcc |
154 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46885551 |
catcttcatatattgatcatgattcggaaatccatcaaaaatattcaagtatgaatgttcttgattattattataagcttcttcttgttgttgatgctca |
46885452 |
T |
 |
| Q |
155 |
tgattcatagctggccagtacggaggttgcatttgcatcccttgaccataatgattcatagtcggcc |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46885451 |
ggattcatagctggccagtacggaggttgcatttgcatcccttgaccataatgattcatagtcggcc |
46885385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 176 - 221
Target Start/End: Complemental strand, 46885304 - 46885259
Alignment:
| Q |
176 |
ggaggttgcatttgcatcccttgaccataatgattcatagtcggcc |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46885304 |
ggaggttgcatttgcatcccttgaccataatgattcatagtcggcc |
46885259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 176 - 221
Target Start/End: Complemental strand, 46885367 - 46885322
Alignment:
| Q |
176 |
ggaggttgcatttgcatcccttgaccataatgattcatagtcggcc |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46885367 |
ggaggttgcatttgcatcccttgaccataatgattcatagtcggcc |
46885322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 206
Target Start/End: Complemental strand, 46885241 - 46885211
Alignment:
| Q |
176 |
ggaggttgcatttgcatcccttgaccataat |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
46885241 |
ggaggttgcatttgcatcccttgaccataat |
46885211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University