View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2158_low_103 (Length: 237)
Name: NF2158_low_103
Description: NF2158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2158_low_103 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 123; Significance: 3e-63; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 3 - 165
Target Start/End: Original strand, 35413148 - 35413310
Alignment:
| Q |
3 |
ttttggtgtttttctgctggtgtgtgctgctgtccttgctgttcttgtgcagcagtttggtttccctctgttggtgtgtctcggcctgttcattggtgag |
102 |
Q |
| |
|
|||| |||||||||| |||||||||||||||||| |||||||||||||||||||||| ||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
35413148 |
tttttgtgtttttctactggtgtgtgctgctgtcgttgctgttcttgtgcagcagttcggtttccctatgttggtgagtctcggcctgttcattggtgag |
35413247 |
T |
|
| Q |
103 |
gcaggggtatgcttggtgttagcaagtatatctcgacctcattgcttgatgccttttttatct |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||| |||||||||| ||||||||| |
|
|
| T |
35413248 |
gcaggggtatgcttggtgttagcaagtatatctcagcctcatcgcttgatgccatttttatct |
35413310 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 99 - 155
Target Start/End: Complemental strand, 4787900 - 4787844
Alignment:
| Q |
99 |
tgaggcaggggtatgcttggtgttagcaagtatatctcgacctcattgcttgatgcc |
155 |
Q |
| |
|
|||||||||||||||||||||| || ||||||||| ||| ||||||| ||||||||| |
|
|
| T |
4787900 |
tgaggcaggggtatgcttggtgctaacaagtatatttcggcctcatttcttgatgcc |
4787844 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University