View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2158_low_108 (Length: 213)
Name: NF2158_low_108
Description: NF2158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2158_low_108 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 14 - 189
Target Start/End: Original strand, 17382980 - 17383156
Alignment:
| Q |
14 |
attattctcaatttgaggatatatagagaaaaacatgaatggtaggcttgtgtaaaagtacatcattttgaggaatatgctatcacatgt-aaccttagc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
17382980 |
attattctcaatttgaggatatatagagaaaaacatgaatggtaggcttgtgtaaaagtacatcattttgaggaatatgctatcacatgtaaaccttagc |
17383079 |
T |
|
| Q |
113 |
tgacccttgcaaatgtatggtcagtggtgttgtaatcctgaacttcaaaaacttgtttgtctttattgtaagccaaa |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17383080 |
tgacccttgcaaatgtatggtcagtggtgttgtaatcctgaacttcaaaaacttgtttgtctttattgtaagccaaa |
17383156 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 14 - 69
Target Start/End: Original strand, 29051419 - 29051475
Alignment:
| Q |
14 |
attattctc-aatttgaggatatatagagaaaaacatgaatggtaggcttgtgtaaa |
69 |
Q |
| |
|
||||||||| ||| |||||||| ||||||||||| ||||||| ||||||||||||| |
|
|
| T |
29051419 |
attattctctaatgtgaggatacatagagaaaaatgtgaatggaaggcttgtgtaaa |
29051475 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University