View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2158_low_24 (Length: 519)
Name: NF2158_low_24
Description: NF2158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2158_low_24 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 254 - 504
Target Start/End: Original strand, 29191613 - 29191863
Alignment:
| Q |
254 |
tggcgggaacagttgcagtaagatcaacagcaacaaactcactgagtgacgagtgggaaatttccttcgcaagattcattccttttccacattcttccat |
353 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29191613 |
tggcgggaacagttgcagtgagatcaacaacaacaaactcactgagtgacgagtgggaaatttccttcgcaagattcattccttttccacattcttccat |
29191712 |
T |
|
| Q |
354 |
cacttcttcttcatcctccgatcttcaccctctccctgtttgcctccgtaaccgtcctccacgtggcacatggatctcctcctccacccccgctttcctc |
453 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
29191713 |
cacttcttcttcatcctccgatcttcaccctctccctgttcgcctccgtaaccgtcctccacgtggcacatggatctcctcctccacctccgctttcctc |
29191812 |
T |
|
| Q |
454 |
cgtttctcctccgatctcaacttctccgatgtcgtcctcaccgttgcattc |
504 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29191813 |
cgtttctcctccgatctcaacttctccgatgtcgtcctcaccgttgcattc |
29191863 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 160; Significance: 5e-85; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 160; E-Value: 5e-85
Query Start/End: Original strand, 254 - 500
Target Start/End: Complemental strand, 33634215 - 33633975
Alignment:
| Q |
254 |
tggcgggaacagttgcagtaagatcaacagcaacaaactcactgagtgacgagtgggaaatttccttcgcaagattcattccttttccacattcttccat |
353 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||| |||||||||||||||| |||||||| || |
|
|
| T |
33634215 |
tggcgggaacagttgcagtaagatcaa---------actcactgagtgacgagtgggaaatttcgttcgcacgattcattccttttcctcattcttcaat |
33634125 |
T |
|
| Q |
354 |
cacttcttcttcatc---ctccgatcttcaccctctccctgtttgcctccgtaaccgtcctccacgtggcacatggatctcctcctccacccccgctttc |
450 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
33634124 |
cacttcttcttcttcttcctccgatcttcaccctctccctgttcgcatccgtaaccgtcctccacgtggcacatggatctcctcctccacctccgctttc |
33634025 |
T |
|
| Q |
451 |
ctccgtttctcctccgatctcaacttctccgatgtcgtcctcaccgttgc |
500 |
Q |
| |
|
||||| |||||||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
33634024 |
ctccgattctcctccgatctcaacttctccgacgtcgttctcaccgttgc |
33633975 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 164 - 196
Target Start/End: Complemental strand, 33634297 - 33634265
Alignment:
| Q |
164 |
agataatttcggccataaattacagagcgtggt |
196 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |
|
|
| T |
33634297 |
agataatttcggccataaattacaaagcgtggt |
33634265 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University