View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2158_low_44 (Length: 423)
Name: NF2158_low_44
Description: NF2158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2158_low_44 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 310; Significance: 1e-174; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 19 - 344
Target Start/End: Complemental strand, 10131116 - 10130792
Alignment:
| Q |
19 |
gtgtccggccacaccgagctataaacgcttttcctcactcagctcattgaaccagaaaggttttgatgtataaagacacttcaaggtagtgccttggatg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10131116 |
gtgtccggccacaccgagctataaacgcttttcctcactcagctcattgaaccagaaaggttttgatgtataaagacacttcaaggtagtgccttggatg |
10131017 |
T |
 |
| Q |
119 |
gattagagggatgagaaataatttacgtctattagatgtttatgttgacgctgtatattatatgtagaagaacttgaacttttttagtttataggacatt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10131016 |
gattagagggatgagaaataatttacgtctattaaatgtttatgttgacgctgtatattatatgtagaagaacttgaacttttttagtttataggacatt |
10130917 |
T |
 |
| Q |
219 |
ttgtatgtaaatattagtttcttcagagtttggctataaacttatggtaacatatcagacatggattttcaaaattgtgtggttttatggaaggatttta |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
10130916 |
ttgtatgtaaatattagtttcttcagagtttggctataaacttatggtaacatatcagacatggattttcaaaattgtgtggtttta-ggaaggatttta |
10130818 |
T |
 |
| Q |
319 |
atatgatgttagagttcattgatttg |
344 |
Q |
| |
|
||||||||||||| |||||||||||| |
|
|
| T |
10130817 |
atatgatgttagatttcattgatttg |
10130792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University