View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2158_low_49 (Length: 397)
Name: NF2158_low_49
Description: NF2158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2158_low_49 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 238; Significance: 1e-131; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 238; E-Value: 1e-131
Query Start/End: Original strand, 132 - 397
Target Start/End: Original strand, 41891160 - 41891427
Alignment:
| Q |
132 |
attgttattgtaccctaaaatgatttactaataaaacacagctatttttatctcacagg--tagtaaagtacgacaagaatgtctcctaacataacttag |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
41891160 |
attgttattgtaccctaaaatgatttactaataaaacacagctatttttatctcacaggagtagtaaagtacgacaagaatgtctccta-cataacttag |
41891258 |
T |
 |
| Q |
230 |
tagtt-attaattttcatgcttgggaagaatcctagccgttgtttatccgcaatcaacgttagagcaatgggtccccaaagttgaaaccgacgcgtgtct |
328 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
41891259 |
tagtttattaattttcatgcttgggaagaatcctagccgttgtttatccgcaatcaacgttagagcaatgggtccccaaagttgacaccgacgcgtgtct |
41891358 |
T |
 |
| Q |
329 |
tatcgcaatcaacggtaatttcataaccgaaatttcaggggacacaacacaacacaacccacaataatc |
397 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41891359 |
tatcgcaatcaacggtaatttcataaccgaaatttcaggggacacaacacaacacaacccacaataatc |
41891427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 90 - 132
Target Start/End: Original strand, 41891097 - 41891139
Alignment:
| Q |
90 |
gatttaaagtcgtgcacaaattataaacgactattatttaaga |
132 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41891097 |
gatttaaagtcgtgcacaaattataaacgactattatttaaga |
41891139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University