View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2158_low_51 (Length: 395)
Name: NF2158_low_51
Description: NF2158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2158_low_51 |
 | |
|
| [»] scaffold0024 (3 HSPs) |
| | |
|
| [»] scaffold0742 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0024 (Bit Score: 161; Significance: 9e-86; HSPs: 3)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 161; E-Value: 9e-86
Query Start/End: Original strand, 174 - 378
Target Start/End: Complemental strand, 114139 - 113942
Alignment:
| Q |
174 |
ttcagtgtcttgaaactcagaaactatttgaaatgaatttcctttttactaggtgtgttggtaccnnnnnnntgttgcacaaaggaaaaacagtagttac |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
114139 |
ttcagtgtcttgaaactcagaaactatttgaaatgaatttcctttttactaggtgtgttggtaccaa-------ttgcacaaagtaaaaacagtagttac |
114047 |
T |
|
| Q |
274 |
aatacaaattttctgaggggaataatttaaccaatacttgctatttatgtttccatcaagctttgaggaattggtttccaaaatacaaccaaatcttgca |
373 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
114046 |
aatgcaaattttctgaggggaataatttaaccaatacttgctatttatgttgccatcaagctttgaggaattggtttccaaaatacaaccaaatcttgca |
113947 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024; HSP #2
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 8 - 117
Target Start/End: Complemental strand, 114305 - 114196
Alignment:
| Q |
8 |
gatgaacactgaacacgtaattttgtcccggtcttgtatatagaatctctgccaagaactatgcatgtgttcttgtaaggtgttcggtaacatacagaaa |
107 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||| |||||| ||||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
114305 |
gatgaacactgaacacgtaattttgtcgcggtcttgtatatagaatctttgccaaaaactatgcatgtgttcttgtaaggtgttctgtaacatactgaaa |
114206 |
T |
|
| Q |
108 |
atgcagccat |
117 |
Q |
| |
|
|||||||||| |
|
|
| T |
114205 |
atgcagccat |
114196 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024; HSP #3
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 19 - 117
Target Start/End: Complemental strand, 120853 - 120755
Alignment:
| Q |
19 |
aacacgtaattttgtcccggtcttgtatatagaatctctgccaagaactatgcatgtgttcttgtaaggtgttcggtaacatacagaaaatgcagccat |
117 |
Q |
| |
|
|||||||||||||||| |||||||| | | |||||||||||||||||||||||||||| ||||||||| ||| |||| |||| |||||||||||||| |
|
|
| T |
120853 |
aacacgtaattttgtcgcggtcttgagcagaaaatctctgccaagaactatgcatgtgtttttgtaaggttttctgtaatatactgaaaatgcagccat |
120755 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0742 (Bit Score: 55; Significance: 2e-22; HSPs: 2)
Name: scaffold0742
Description:
Target: scaffold0742; HSP #1
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 248 - 339
Target Start/End: Complemental strand, 181 - 88
Alignment:
| Q |
248 |
ttgcacaaaggaaaaacagtagttacaatacaaattttct--gaggggaataatttaaccaatacttgctatttatgtttccatcaagctttga |
339 |
Q |
| |
|
|||||||||| |||||||||||||||||| |||| ||||| |||||||||||||||||||||||||| ||||||| | |||||||||||||| |
|
|
| T |
181 |
ttgcacaaagtaaaaacagtagttacaatgcaaaatttctatgaggggaataatttaaccaatacttgatatttatatagccatcaagctttga |
88 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0742; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 25 - 101
Target Start/End: Complemental strand, 362 - 286
Alignment:
| Q |
25 |
taattttgtcccggtcttgtatatagaatctctgccaagaactatgcatgtgttcttgtaaggtgttcggtaacata |
101 |
Q |
| |
|
|||||||||| |||||||| | | ||||||||||||||||||||||| |||| || ||| || ||| |||||||| |
|
|
| T |
362 |
taattttgtcgcggtcttgagcagaaaatctctgccaagaactatgcatatgtttttttaaagttttctgtaacata |
286 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University