View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2158_low_62 (Length: 350)
Name: NF2158_low_62
Description: NF2158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2158_low_62 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 325; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 325; E-Value: 0
Query Start/End: Original strand, 1 - 333
Target Start/End: Original strand, 45794603 - 45794935
Alignment:
| Q |
1 |
ccaagaaatgattccattatgattgttcttgaatattggtcacgcggagttcccaaacatgtcgaaccaacaagacttttatcactgattttgccttgtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
45794603 |
ccaagaaatgattccattatgattgttcttgaatattggtcacgcggagttcccaaacatgtcgaaccaacaagacttttatcattgattttgccttgtt |
45794702 |
T |
 |
| Q |
101 |
ctgctatgatggtgcagttttggatcacaagtccagttttctcatatttgtctagtcttgattgaacactcaccacattttttctcagagctaagctaga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45794703 |
ctgctatgatggtgcagttttggatcacaagtccagttttctcatatttgtctagtcttgattgaacactcaccacattttttctcagagctaagctaga |
45794802 |
T |
 |
| Q |
201 |
agaatttcgatgcttcacaattatttgcgagttttgaattatagttgctgagtctcctttgatgatgtctacactaccatgaatttcgcagtctctgtag |
300 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45794803 |
agaatttcggtgcttcacaattatttgcgagttttgaattatagttgctgagtctcctttgatgatgtctacactaccatgaatttcgcagtctctgtag |
45794902 |
T |
 |
| Q |
301 |
aattggcgctgcgcgactgcgtataagcttcct |
333 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
45794903 |
aattggcgctgcgcgactgcgtataagcttcct |
45794935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University