View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2158_low_76 (Length: 301)
Name: NF2158_low_76
Description: NF2158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2158_low_76 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 18 - 291
Target Start/End: Complemental strand, 34258071 - 34257798
Alignment:
| Q |
18 |
ataaaacactatcttgttcttcctcctactgtggatctcagattccgccacaaaattcttataacggaacggatcctgtatcgagtctgaggagttgtga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
34258071 |
ataaaacactatcttgttcttcctcctactgtggatctcagattccgccacaaaattcttataacgaaacggatcctgtatcgagtctgaggagttgtga |
34257972 |
T |
 |
| Q |
118 |
agggaacttgctcagctcacgagaaatatttttgaacacgtctatgcatgagattatgggagcatcttgttctggagttgattcttccaaggaagaggga |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34257971 |
agggaacttgctcagctcacgagaaatatttttgaacacgtctatgcatgagattatgggagcatcttgttctggagttgattcttccaaggaagaggga |
34257872 |
T |
 |
| Q |
218 |
cacaatggtgtacatttagttccatcactccctaattcagataatcggtctaactgttttcctcaatctctctg |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34257871 |
cacaatggtgtacatttagttccatcactccccaattcagataatcggtctaactgttttcctcaatctctctg |
34257798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University