View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2158_low_78 (Length: 297)
Name: NF2158_low_78
Description: NF2158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2158_low_78 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 172; Significance: 2e-92; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 17 - 283
Target Start/End: Complemental strand, 2230260 - 2229998
Alignment:
| Q |
17 |
atctatctcataacttcaactatgataacaatgtgtactggtgccaactttggaatggatctcaagtactatgacacttcttttaatagtattgatattt |
116 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
2230260 |
atctatctgataacttcaactatgataacaatgtgtactggtgccaactttggaatggatctcaagtactacgacacttcttttaatagtattaatattt |
2230161 |
T |
 |
| Q |
117 |
tctcaactgcatattattatggttagtatatacattattaaattgttgaattattctctcaactgcattgacaactgcatattattannnnnnnnnnnnn |
216 |
Q |
| |
|
||||||||||||| ||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
2230160 |
tctcaactgcata---ttatggttagtatatacgttattaaattgttgaattattcactcaactgcattgacaactgcatattatta-ttttttattttt |
2230065 |
T |
 |
| Q |
217 |
nnnagaaagacaactgcatattattatcagtacttttatcacttgtcacattcttattaaattctat |
283 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
2230064 |
tttagaaagacaactacatattattatcagtacttttatcacttgtcacaatcttattaaattctat |
2229998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 45 - 122
Target Start/End: Complemental strand, 2227042 - 2226965
Alignment:
| Q |
45 |
caatgtgtactggtgccaactttggaatggatctcaagtactatgacacttcttttaatagtattgatattttctcaa |
122 |
Q |
| |
|
||||||| ||||| ||||||||||||||||||||||||||||| ||||||||| ||||||||||| |||||||||||| |
|
|
| T |
2227042 |
caatgtgcactggggccaactttggaatggatctcaagtactacgacacttctattaatagtattaatattttctcaa |
2226965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University