View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2158_low_81 (Length: 296)
Name: NF2158_low_81
Description: NF2158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2158_low_81 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 6 - 278
Target Start/End: Original strand, 44722052 - 44722324
Alignment:
| Q |
6 |
agtgagatgaatttcaagtaaaggaatgtgtatggaaattgtaattaactgattcatttattcttctctcggctaaatatctctctcaaatgcaaataac |
105 |
Q |
| |
|
|||||| |||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44722052 |
agtgagctgaatttcaagtaaaggaatgtttatggaaattgtaattaaccgattcatttattcttctctcggctaaatatctctctcaaatgcaaataac |
44722151 |
T |
 |
| Q |
106 |
tttttaggtccagcaaattagagtgtgaatgaagtctgttttgtggttatatgtcagatgcaaacattctataccacaacttgtggtgttgtccaacacc |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44722152 |
tttttaggtccagcaaattagagtgtgaatgaagtctgttttgtggttatatgtcagatgcaaacattctataccacaacttgtggtgttgtccaacacc |
44722251 |
T |
 |
| Q |
206 |
tcannnnnnncaattttgtatattaacaaaataaaatgatatttgtcttataacatatatagagtggttgtta |
278 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44722252 |
tcatttttttcaattttgtatattaacaaaataaaatgatatttgtcttataacatatatagagtggttgtta |
44722324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University