View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2158_low_89 (Length: 259)
Name: NF2158_low_89
Description: NF2158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2158_low_89 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 119; Significance: 7e-61; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 117 - 243
Target Start/End: Original strand, 38030164 - 38030290
Alignment:
| Q |
117 |
atatcactgtgacaaagagaggtgcatataatacgaatcctagcttcatgtggcattggtggtgccacaaaaatatcctcaataatcagtggctcacctg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
38030164 |
atatcactgtgacaaagagaggtgcatataatacgaatcctagcttcatgtggcattggtggtgccacaaaaatctcctcaataatcagtggctcacctg |
38030263 |
T |
 |
| Q |
217 |
gtttgtgacaaaccgcagctacaaaat |
243 |
Q |
| |
|
||||| ||||||||||||||||||||| |
|
|
| T |
38030264 |
gtttgcgacaaaccgcagctacaaaat |
38030290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University