View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2158_low_94 (Length: 250)
Name: NF2158_low_94
Description: NF2158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2158_low_94 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 241
Target Start/End: Complemental strand, 41659680 - 41659442
Alignment:
| Q |
1 |
gtattagctaatagcttagctataagaagtaagaacatagaggacatgacaattgaaccaatcatgttatgttaatcagactttgatttcgtgatttatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
41659680 |
gtattagctaatagcttagctataagaagtaagaacatagaggacataacaattgaaccaatcatgttatgttaatcaaactttgatttcgtgatttatt |
41659581 |
T |
|
| Q |
101 |
ataagttataatcaattagtattattaaatataactatataggggctgatatgtatggtacaacaaccactcgatttacatgttggaatggtttaaaacc |
200 |
Q |
| |
|
|||||||||||||||||||||||| | |||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
41659580 |
ataagttataatcaattagtattagt-aatataactata-gggggctgatatatatggtacaacaaccactcgatttacatgttggaatggtttaacacc |
41659483 |
T |
|
| Q |
201 |
gatttaacaccaaacgtcaactcaatttttattcttcatat |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
41659482 |
gatttaacaccaaacgtcaactcaatttttattctttatat |
41659442 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University