View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2158_low_95 (Length: 250)
Name: NF2158_low_95
Description: NF2158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2158_low_95 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 23407531 - 23407772
Alignment:
| Q |
1 |
tagatctatgtatcatagggagggtggtggtgaacaaactggttcacctatgtacgattgaagaaagactagggagcatgtggcaatcttggagaaaaat |
100 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23407531 |
tagatctatgtctcatagggagggtggtggtgaacaaactggttcacctatgtacgattgaagaaagactagggagcatgtggcaatcttggagaaaaat |
23407630 |
T |
 |
| Q |
101 |
tactttaatgtctatggaggataataagtatatggttcaatttttataa-gtgatcgggagagaatttttcaaggaagtccttgactaattgat-aaaat |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||| |||||| ||||||||||||||| |||||| |||||||||||||| ||||| |
|
|
| T |
23407631 |
tactttaatgtctatggaggataataagtatatggttcaattgttataaggtgatctggagagaatttttcatggaagtacttgactaattgataaaaat |
23407730 |
T |
 |
| Q |
199 |
aagattatcttgcagaacgttgctataggtgaagatcctatg |
240 |
Q |
| |
|
| ||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
23407731 |
atgatcatcttgcagaaggttgctataggtgaagatcctatg |
23407772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University