View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21590_high_9 (Length: 258)
Name: NF21590_high_9
Description: NF21590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21590_high_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 141; Significance: 5e-74; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 73 - 235
Target Start/End: Original strand, 55695428 - 55695587
Alignment:
| Q |
73 |
ctacttttttcacatgtcaaagttgatgagaagcttttccgctttatttgtttggtttcttttgtcattgatcttattgtgaaggtaagtctatgggtat |
172 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
55695428 |
ctacttttttcacatgtcaaagttgatgagaagcttttctgctttatttgtttggcttcttttgtcattgatcttattgtgaaggta---ctatgggtat |
55695524 |
T |
|
| Q |
173 |
ggctttacggatttattattatataaggagctatagccactgaagcttgtttggtcattatgt |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55695525 |
ggctttacggatttattattatataaggagctatagccactgaagcttgtttggtcattatgt |
55695587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 19 - 53
Target Start/End: Original strand, 55695385 - 55695419
Alignment:
| Q |
19 |
cacagaagcataaaaagtgatcagaaaggagtcta |
53 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
55695385 |
cacagaagcataaaaagtgatcagaaaggagtcta |
55695419 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 78 - 196
Target Start/End: Complemental strand, 35804319 - 35804198
Alignment:
| Q |
78 |
tttttcacatgtcaaagttgatgagaagcttttccgctttatttgtttggtttc---ttttgtcattgatcttattgtgaaggtaagtctatgggtatgg |
174 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |||||||||||||||| |||| |||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
35804319 |
tttttcacaagtcaaagttgatgagaagcttttctattttatttgtttggttttgttttttttcattgatcttattttgaaggtaagtctttgggtatgg |
35804220 |
T |
|
| Q |
175 |
ctttacggatttattattatat |
196 |
Q |
| |
|
|||||| || |||||||||||| |
|
|
| T |
35804219 |
ctttacagaattattattatat |
35804198 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University