View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21591_high_4 (Length: 287)
Name: NF21591_high_4
Description: NF21591
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21591_high_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 164; Significance: 1e-87; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 12 - 183
Target Start/End: Original strand, 44965672 - 44965843
Alignment:
| Q |
12 |
atgagagtggtaacgaagcatttgggtaagagtaggtcatcgggtacggtggccggagccagttctccggcgaacaggagtgatgatacgctgttgcagc |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
44965672 |
atgagagtggtaacgaagcatttgggtaagagtaggtcatcgggtacggtggccggagctagttctccggcgaacaggagtgatgatacgttgttgcagc |
44965771 |
T |
|
| Q |
112 |
agcatgatggaattcaaagtgctattcttcattgcaagagatccttcaattccagaggtaaaatttgtttca |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44965772 |
agcatgatggaattcaaagtgctattcttcattgcaagagatccttcaattccagaggtaaaatttgtttca |
44965843 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 179 - 268
Target Start/End: Complemental strand, 44965129 - 44965040
Alignment:
| Q |
179 |
tttcagttttggttttgacatgttggtcgtcgctcatggtaagttctaagtcgaagaatgagtcatcttcgtctgattcactgtctgttt |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44965129 |
tttcagttttggttttgacatgttggtcgtcgctcatggtaagttctaagtcgaagaatgagtcatcttcgtctgattcactgtctgttt |
44965040 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 91 - 161
Target Start/End: Original strand, 2502541 - 2502611
Alignment:
| Q |
91 |
gtgatgatacgctgttgcagcagcatgatggaattcaaagtgctattcttcattgcaagagatccttcaat |
161 |
Q |
| |
|
|||||||| |||| ||||||||||| |||||||||||| | || ||| | || |||||||||||||||||| |
|
|
| T |
2502541 |
gtgatgattcgcttttgcagcagcaagatggaattcaaggagccattttacactgcaagagatccttcaat |
2502611 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 32 - 131
Target Start/End: Original strand, 28697958 - 28698056
Alignment:
| Q |
32 |
tttgggtaagagtaggtcatcgggtacggtggccggagccagttctccggcgaacaggagtgatgatacgctgttgcagcagcatgatggaattcaaagt |
131 |
Q |
| |
|
|||||||||||||||||| ||| ||| |||||||||| || |||||||||| | ||||||||| | | |||||||||| |||||||||| |||||| |
|
|
| T |
28697958 |
tttgggtaagagtaggtcgccggataccgtggccggagttggtactccggcgaataagagtgatga-atgttgttgcagcaagatgatggaatccaaagt |
28698056 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University