View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21592_high_2 (Length: 464)
Name: NF21592_high_2
Description: NF21592
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21592_high_2 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 165; Significance: 4e-88; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 165; E-Value: 4e-88
Query Start/End: Original strand, 249 - 456
Target Start/End: Original strand, 19117470 - 19117675
Alignment:
| Q |
249 |
tcggatgtgacattcgagtttgcttaccaatttgacattcaccataattgttgtccttaacaacttttagtttaggtaaccctctaattgcttctacata |
348 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||| || ||||||| ||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
19117470 |
tcggatgtgacatttgagtttgcttaccaatttgacattcaccacaaatgttgtcattaacaatttttagtttaggtaaccctctaattgcttctacata |
19117569 |
T |
 |
| Q |
349 |
tatggctttcttcatacctctcaggtttaaatgaccaagtttctggtgccacatatatttacctcttcttctttactaacaagataggttgacaagttag |
448 |
Q |
| |
|
|||||||||||| ||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
19117570 |
tatggctttctttatacctctcagatttaaatgaccaagtttctggtgccac--atatttacctcttcttctttactaataagataggttgacaagttag |
19117667 |
T |
 |
| Q |
449 |
cttcttct |
456 |
Q |
| |
|
|||||||| |
|
|
| T |
19117668 |
cttcttct |
19117675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 92; E-Value: 2e-44
Query Start/End: Original strand, 18 - 154
Target Start/End: Original strand, 19114225 - 19114363
Alignment:
| Q |
18 |
agacatgtattggaaactggcctaccagatcgttgaaccgcacataaactatgcataaaccacttctttgtacgcctcttttagatcagcactattcgga |
117 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||| ||||||||||||||| ||||||| ||| |
|
|
| T |
19114225 |
agacatgtattgcaaactggcctaccagatcgttgaactgcacataaagaatgcataaaccacttctttgtaagcctcttttagatcatcactatttgga |
19114324 |
T |
 |
| Q |
118 |
tcatcggacagcgct--gcccccttctctttggtcttct |
154 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
19114325 |
tcatcggacaacgcttcccccccttctctttggtcttct |
19114363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University