View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21592_low_12 (Length: 273)
Name: NF21592_low_12
Description: NF21592
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21592_low_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 19 - 259
Target Start/End: Complemental strand, 39863417 - 39863175
Alignment:
| Q |
19 |
gaatatgctcgagattgaatgggattgtaaaggttgaatccaacgcaatcacgcaagtgcaatcggcttctattttannnnnnnncatcttatttctggt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
39863417 |
gaatatgctcgagattgaatgggattgtaaaggttgaatccaacgcaatcacgcaagtgcaatcggcttctattttattttttt-catcttatttctggt |
39863319 |
T |
 |
| Q |
119 |
atac---gtctcgccgcatttgccatggaccccacggaaccttcccccactttacattgtggtgcccacatatacctcagcttccactaattgttcaatc |
215 |
Q |
| |
|
|| | |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39863318 |
atgctgcgtctcgccgcatttgctatggaccccacggaaccttcccccactttacattgtggtgcccacatatacctcagcttccactaattgttcaatc |
39863219 |
T |
 |
| Q |
216 |
aatcagatactcctaacattgggttctatccactctctatgccc |
259 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39863218 |
aatctgatactcctaacattgggttctatccactctctatgccc |
39863175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 122 - 158
Target Start/End: Original strand, 5595190 - 5595226
Alignment:
| Q |
122 |
cgtctcgccgcatttgccatggaccccacggaacctt |
158 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5595190 |
cgtctcgccgcatttgccatggaccccacggaacctt |
5595226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University