View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21592_low_16 (Length: 219)
Name: NF21592_low_16
Description: NF21592
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21592_low_16 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 96; Significance: 3e-47; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 94 - 197
Target Start/End: Original strand, 33817307 - 33817410
Alignment:
| Q |
94 |
ctttaagtgtactcgcttttctatcttgcagaagaagtgttgagcaggggcatttctaaaccggtggataatggtgatttagagttgatgtcaagcacta |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33817307 |
ctttaagtgtactcgcttttctatcttgcagaagaagtgttgagcacgggcatttctaaactggtggataatggtgatttagagttgatgtcaagcacta |
33817406 |
T |
|
| Q |
194 |
gaag |
197 |
Q |
| |
|
|||| |
|
|
| T |
33817407 |
gaag |
33817410 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 1 - 104
Target Start/End: Complemental strand, 33806751 - 33806648
Alignment:
| Q |
1 |
tgatagtctgagttagttcttaatagggttgaacaggttacacaggtacacatttcaagccaaaggtgtttgcaaatgaatctgtccagtcttctttaag |
100 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
33806751 |
tgatggtctaagttagttcttaatagggttgaacaggttacacaggtacacatttcaagccaaaggtgtttgcaaatgaatctgtccagtcttctttcag |
33806652 |
T |
|
| Q |
101 |
tgta |
104 |
Q |
| |
|
|||| |
|
|
| T |
33806651 |
tgta |
33806648 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University